CRISPR Indels

This application helps extract the indel sequences from raw NGS reads. It takes two inputs: (1). Input 1: a .FASTQ file containing the raw NGS reads. A sample file can be found here, and (2). Input 2: the reference sequence, which contains the variable region (indels) flanked by L and R symbols. A sample reference is shown here:

CCGCCCTCGACCGCCTTGATTCTCATGGTCTGGGTGCLCCTCGTAGGGCTTGCCTTCGCCCTCGGATGTGCACTTGAARGTGGTGGTTGTTCACGGTGCCCT

The output file (.csv format) contains extracted unique indels, along with their corresponding counts.

For reference, please cite: Genetic physical unclonable functions in human cells. Science Advances (2022)