
Target sequence
This application helps extract the indel sequences from raw NGS reads. It takes two inputs:
(1). Input 1: a .FASTQ file containing the raw NGS reads. A sample file can be found here, and
(2). Input 2: the reference sequence, which contains the variable region (indels) flanked by L and R symbols. A sample reference is shown here:
CCGCCCTCGACCGCCTTGATTCTCATGGTCTGGGTGCLCCTCGTAGGGCTTGCCTTCGCCCTCGGATGTGCACTTGAARGTGGTGGTTGTTCACGGTGCCCT
The output file (.csv format) contains extracted unique indels, along with their corresponding counts.
For reference, please cite:
Genetic physical unclonable functions in human cells. Science Advances (2022)